1. Search Result
Search Result
Results for "

viral proteins

" in MedChemExpress (MCE) Product Catalog:

59

Inhibitors & Agonists

5

Screening Libraries

1

Biochemical Assay Reagents

1

Inhibitory Antibodies

9

Natural
Products

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-109045A

    BTA074 hydrochloride; AP 611074 hydrochloride

    E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) hydrochloride is a potent antiviral agent. Teslexivir hydrochloride is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir hydrochloride can be used for condyloma research .
    Teslexivir hydrochloride
  • HY-105721

    SARS-CoV Infection
    Aranotin strongly binds to Nsp15 viral protein. Aranotin can be used as promising SARS-CoV-2 replication strong inhibitor. Aranotin has the potential for COVID-19 research .
    Aranotin
  • HY-109045

    BTA074; AP 611074

    E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) is a potent antiviral agent. Teslexivir is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir can be used for condyloma research .
    Teslexivir
  • HY-157236

    Others Others
    AEX Anion-exchange resin 1 is a strong anion exchange chromatography resin, based on monodisperse polystyrene/divinylbenzene (PS-DVB), with a particle size of 50 μm and an ionic ligand of –CH2N + (CH3)3. AEX Anion-exchange resin 1 can be used for the separation and purification of biological macromolecules such as proteins, antibodies, and viral vaccines.
    AEX Anion-exchange resin 1
  • HY-152027

    HSP Apoptosis Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-18 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-18 has effective Hsp90 inhibitory activity with an IC50 value of 0.39 μM. HSP90-IN-18 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-18
  • HY-152028

    HSP Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-19 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-19 has effective Hsp90 inhibitory activity with an IC50 value of 0.27 μM. HSP90-IN-19 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-19
  • HY-145850

    Enterovirus Infection
    EV-A71-IN-1 is a human enterovirus A71 (EV-A71) capsid protein inhibitor with an EC50 of 0.27 μM against EV-A71. EV-A71-IN-1 is a capsid binder that blocks the interaction between the viral VP1 and the host receptor hSCARB2. EV-A71-IN-1 inhibits a series of different human enteroviruses without significant cytotoxicity (CC50>56.2 μM) .
    EV-A71-IN-1
  • HY-148170

    EBV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Infection
    L-I-OddU, a L-5'-halo- dioxolane nucleoside analogue, is a potent and selective anti-Epstein-Barr virus (EBV) agent with an EC50 value of 0.03μM. L-I-OddU has low cytotoxicity with a CC50 value of 1000 nM. L-I-OddU has antiviral activity by suppressing replicative EBV DNA and viral protein synthesis .
    L-I-OddU
  • HY-146226

    Enterovirus Infection
    Viral 2C protein inhibitor 1 (compound 6aw) is a potent and broad-spectrum enterovirus antiviral agent, inhibiting viral 2C protein. Viral 2C protein inhibitor 1 inhibits multiple strains of EV-D68, EV-A71 and CVB3 with EC50s of 0.1~3.6 µM, and exhibits high selectivity index and relatively low cytotoxicity .
    <em>Viral</em> 2C <em>protein</em> inhibitor 1
  • HY-124512

    Pentaacetylquercetin

    RSV Infection Inflammation/Immunology
    Quercetin pentaacetate could interact with F-protein with lower binding energy and better stability to block viral adhesion. Quercetin pentaacetate interacts with RSV and inhibit the viral adhesion on cell surface .
    Quercetin pentaacetate
  • HY-106312A

    LY122772

    Enterovirus Infection
    Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .
    Enviroxime
  • HY-148348

    HBV Infection
    AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein .
    AB-836
  • HY-139850

    HIV Infection
    GPS491 (EC50 = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.
    GPS491
  • HY-163029

    Cathepsin SARS-CoV Infection
    CTSLCTSB-IN-1 (compound 212-148) is a bispecific inhibitor of host viral spike cleaver proteins CTSL/CTSB and TMPRSS2 with IC50s of 2.13/64.07 nM and 1.38 μM, respectively. CTSLCTSB-IN-1 blocks two relevant SARS-CoV-2 viral entry pathways by inhibiting the viral spike cleavage and can be applied to anti-SARS-CoV-2 research .
    CTSL/B-IN-1
  • HY-147314

    HIV Src Infection
    HIV-IN-6 is a HIV-Ⅰ viral replication inhibitor by targeting Src family kinases (SFK) that interact with Nef protein of the virus, such as Hck .
    HIV-IN-6
  • HY-119210

    HIV Infection
    ZINC04177596 is a potent HIV-negative factor (HIV-Nef) protein inhibitor. Nef is an accessory gene product of HIV and has an imperative role in viral replication and AIDS pathogenesis .
    ZINC04177596
  • HY-113761

    Filovirus Infection
    ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .
    ASN03576800
  • HY-19874

    RFI-641 is a selective inhibitor of the respiratory syncytial virus (RSV), with an IC50 of 50 nM. RFI-641 inhibit binding and fusion of enveloped virus via interaction with the viral fusion protein .
    RFI-641
  • HY-102077

    HIV Infection
    SAMT-247 is a microbicide that selectively inactivate the viral nucleocapsid protein NCp7, causing zinc ejection and preventing RNA encapsidation. SAMT-247 shows good antiviral activity .
    SAMT-247
  • HY-118870

    Endogenous Metabolite Inflammation/Immunology
    γ-Globulins from human blood are a class of proteins in the blood. γ-Globulin is a protein fraction of blood serum containing many antibodies that protect against bacterial and viral infectious diseases. γ-Globulins from human blood is used for common variable immunodeficiency
    γ-Globulins from human blood
  • HY-N2000

    Bellidifolin is a xanthone isolated from the stems of Swertia punicea, with hepatoprotective, hypoglycemic, anti-oxidation, anti-inflammatory and antitumor activities . Bellidifolin also acts as a viral protein R (Vpr) inhibitor .
    Bellidifolin
  • HY-148768

    HBV Inflammation/Immunology
    AB-506 is an orally active inhibitor of HBV replication targeting the viral core protein. AB-506 can bind to HBV core protein, accelerate capsid assembly and inhibit HBV pgRNA encapsidation. AB-506 can be used in chronic hepatitis B (CHB) research .
    AB-506
  • HY-N2036

    Enterovirus Bacterial Infection
    Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with  anti-EV71 activity. Mosloflavone  inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.
    Mosloflavone
  • HY-138941

    C12E8

    Influenza Virus Infection
    Octaethylene glycol monododecyl ether (C12E8) is an non-ionic detergent that can be used for membrane protein extraction. Octaethylene glycol monododecyl ether can solubilize the viral membrane of intact influenza virus .
    Octaethylene glycol monododecyl ether
  • HY-W555382

    2-Nonylquinolin-4(1H)-one

    HCV Infection
    Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC50 value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .
    Pseudane IX
  • HY-B1268
    Docusate Sodium
    1 Publications Verification

    Dioctyl sulfosuccinate sodium salt

    HSV Others
    Docusate Sodium (Dioctyl sulfosuccinate sodium salt) is one of the main components in stool softeners. Docusate Sodium is a sulfated surfactant and may inactivate viral pathogens by disrupting viral envelopes and/or denaturing/disassociating proteins. Docusate Sodium is effective in vitro against wild type and drug-resistant strains of HSV type 1 and 2. Docusate Sodium is an obesogen. Docusate Sodium with developmental exposure leads to increased adult adiposity, inflammation, metabolic disorder and dyslipidemia in offspring fed a standard diet in mice .
    Docusate Sodium
  • HY-B0751

    Amebacilin; NSC9168

    Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
    Fumagillin
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-P99346

    CT-P59

    SARS-CoV Angiotensin-converting Enzyme (ACE) Infection
    Regdanvimab (CT-P59) is a human monoclonal antibody that targets the receptor-binding domain of SARS-CoV-2 spike protein, blocking interaction with ACE2 for viral entry. Regdanvimab can be used for the research of COVID-19 .
    Regdanvimab
  • HY-136782

    Flavivirus Dengue virus Infection
    ST-148 maleate is a potent and orally active DENV inhibitor. ST-148 maleate shows antiviral efficacy and low cell toxicity. ST-148 alters the interaction between lipid droplets and the C protein, thereby inhibiting viral replication. .
    ST-148 maleate
  • HY-148328

    Casein Kinase Infection Inflammation/Immunology Cancer
    CK2-IN-4 (compound 5) is a protein kinase (CK2) inhibitor (IC50=8.6 µM). CK2-IN-4 has good potential for research in the areas of cancer, viral infections and glomerulonephritis .
    CK2-IN-4
  • HY-16957

    LJ001 is a broad-spectrum and orally active antiviral agent. LJ001 exerts antiviral activities by binding to viral membranes. LJ001 inhibits TGEV and PDCoV infection. LJ001 decreases TGEV N and PDCoV N-protein expression .
    LJ001
  • HY-148837

    c-Myc Casein Kinase Infection Cardiovascular Disease Cancer
    c-Myc inhibitor 7 is a c-Myc inhibitor and a multiple target protein degrader. c-Myc inhibitor 7 effective degrades c-MYC, CK1α, GSPT1 and IKZF1/2/3 proteins in a variety of tumor cells. c-Myc inhibitor 7 can be used for c-Myc high expression related disease research, such as cancer, cardiovascular and cerebrovascular diseases, and viral infection .
    c-Myc inhibitor 7
  • HY-148836

    c-Myc Infection Cardiovascular Disease Cancer
    c-Myc inhibitor 6 (compound A102) is a c-Myc inhibitor. c-Myc inhibitor 6 decreases cancer cell viability and degrades c-Myc protein. c-Myc inhibitor 6 can be used for the research of c-Myc imbalance, such as cancer, cardiovascular diseases, and viral infection .
    c-Myc inhibitor 6
  • HY-108717
    Proteinase K
    5 Publications Verification

    Protease K

    Ser/Thr Protease Others
    Proteinase K (Protease K) is a nonspecific serine protease that is useful for general digestion of proteins. Proteinase K is active in the presence of SDS or urea and over a wide range of pH (4-12), salt concentrations, and temperatures. Proteinase K can be use for promoting methods of viral nucleic acid extraction, and detection .
    Proteinase K
  • HY-N1535
    Ponicidin
    2 Publications Verification

    Rubescensine B

    Apoptosis Inflammation/Immunology Cancer
    Ponicidin (Rubescensine B) is a diterpenoid derived from Rabdosia rubescens, and exhibits immunoregulatory, anti-inflammatory, anti-viral and anti-cancer activity. Ponicidin (Rubescensine B) induces apoptosis of gastric carcinoma cell, decreases the phosphorylation of JAK2 and STAT3, and shows no effect on protein levels of JAK2 and STAT3 .
    Ponicidin
  • HY-145871

    HBV Infection
    BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM .
    BA38017
  • HY-154968

    RSV Infection
    RSV L-protein-IN-5 (compound E) is a potent inhibitor of Respiratory syncytial virus (RSV) (EC50=0.1 μM). RSV L-protein-IN-5 inhibits Polymerase (IC50=0.66 μM),and blocks RSV mRNA synthesis by inhibiting guanylation of viral transcripts. RSV L-protein-IN-5 shows moderate cytotoxicity (CC50=10.7 μM,HEp-2),also exhibits activity and lowers virus titers in mouse models of RSV infection .
    RSV L-protein-IN-5
  • HY-115574

    RSV Infection
    RSV L-protein-IN-1 (compound D) is a potent inhibitor of Respiratory syncytial virus (RSV) (EC50=0.021 μM). RSV L-protein-IN-1 inhibits Polymerase (IC50=0.089 μM),and blocks RSV mRNA synthesis by inhibiting guanylation of viral transcripts. RSV L-protein-IN-1 shows moderate cytotoxicity (CC50=8.4 μM,HEp-2),also exhibits activity and lowers virus titers in mouse models of RSV infection .
    RSV L-protein-IN-1
  • HY-124806

    Enterovirus DNA/RNA Synthesis HCV Infection
    TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC50=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP) .
    TTP-8307
  • HY-N3187

    Flavivirus Dengue virus Fungal Bacterial Histamine Receptor Infection Neurological Disease Inflammation/Immunology Cancer
    Nimbin is a intermediate limonoid isolated from Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin can across blood-brain barrier .
    Nimbin
  • HY-144260

    SARS-CoV Infection
    3CPLro-IN-1 (compound A17) is a potent and orally active inhibitor of SARS-CoV-2 3CLpro with an IC50 of 5.65 μM. 3-Chymotrypsin-like cysteine protease (3CLpro) is an indispensable protein in viral replication and represents an attractive agent target for fighting COVID-19 .
    3CPLro-IN-1
  • HY-156346

    SARS-CoV Infection
    HCoV-OC43-IN-1 (Compound IV-16) is a coronavirus HCoV-OC43 inhibitor. HCoV-OC43-IN-1 has antiviral efficacy (EC50: 90 nM). HCoV-OC43-IN-1 inhibits the mRNA level and expression of viral nucleocapsid protein (NP) .
    HCoV-OC43-IN-1
  • HY-120072
    PF-3450074
    3 Publications Verification

    PF-74

    HIV Infection
    PF-3450074 (PF-74) is a specifical inhibitor of HIV-1 capsid protein (CA) and displays a broad-spectrum inhibition of HIV isolates with submicromolar potency (EC50=8-640 nM). PF-3450074 (PF-74) acts at an early stage of HIV-1 infection, inhibits viral replication by directly competing with the binding of CPSF6 and NUP153, and blocks the uncoating, assembly, and the reverse transcription steps of the viral life cycle . CPSF6: nuclear host factors cleavage and polyadenylation specific factor 6; NUP153: nucleoporin 153.
    PF-3450074
  • HY-107577

    HSP Infection Inflammation/Immunology Cancer
    Gedunin is a limonoid with anti-cancer, anti-viral, anti-inflammatory and insecticidal activities. Gedunin acts as a potent Hsp90 inhibitor and induces the degradation of Hsp90-dependent client proteins. Geduni may obstructs the entry of SARS-CoV-2 virus into human host cells and can be used for COVID-19 research .
    Gedunin
  • HY-121138

    ARDP0006; DHDNE

    Flavivirus Dengue virus Virus Protease Infection
    1,8-Dihydroxy-4,5-dinitroanthraquinone (ARDP0006; DHDNE) is a potent inhibitor of serine proteinase NS2B/3, the dengue viral protein. 1,8-Dihydroxy-4,5-dinitroanthraquinone has intermolecular proteinase activity and viral inhibition ability with IC50s of 432 μM and 4.2 μM, respectively. Meanwhile 1,8-Dihydroxy-4,5-dinitroanthraquinone inhibits NS2B/3 cleavage in BHK-21 cells at a dose ranging from 4.2 μM to 432 μM .
    1,8-Dihydroxy-4,5-dinitroanthraquinone
  • HY-144263

    SARS-CoV Infection
    3CPLro-IN-2 (compound C1) is a potent and orally active inhibitor of SARS-CoV-2 3CLpro with an IC50 and Ki of 1.55 and 6.09 μM, respectively. 3-Chymotrypsin-like cysteine protease (3CLpro) is an indispensable protein in viral replication and represents an attractive agent target for fighting COVID-19 .
    3CPLro-IN-2
  • HY-126419

    SARS-CoV PKC Infection
    Kobophenol A, an oligomeric stilbene, blocks the interaction between the ACE2 receptor and S1-RBD with an IC50 of 1.81 μM and inhibits SARS-CoV-2 viral infection in cells with an EC50 of 71.6 μM. Kobophenol A inhibits the activity of partially purified rat brain protein kinase C (PKC) with an IC50 of 52 µM .
    Kobophenol A
  • HY-152101

    SARS-CoV Infection
    LY1 is a potent, selective and covalent inhibitor against both SARS-CoV-2 PL pro and M pro with Kd values of 1.5 μM and 2.3 μM for M pro C145A protein and PL pro C111A protein, respectively. LY1 potent against the viral proteases, with IC50s of 0.12 μM and 0.99 μM against M pro and PL pro. LY1 shows high selectivity over other kinases, human proteases and metalloenzyme .
    LY1

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: